Recombination porcine interferon gamma-Fc fusion protein as well as coding gene and expression method thereof (2023)

[0005] However, most recombinant proteins expressed by E. coli are insoluble, inactive intracellular aggregates known as inclusion bodies

The renaturation of inclusion bodies is a very complicated process. If the renaturation conditions are not suitable, there will be mismatching of disulfide b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

View more

[0066] Example 1 Recombinant porcine interferon gamma-Fc fusion protein gene optimization design

[0067] According to the cDNA sequence (GenBank accession number: NM_213948.1) and pig IgG Fc fragment (Sus scrofa IgG heavy chain) cDNA sequence (GenBank accession number: In the hinge region, CH2 region and CH3 region of NM_213828.1), these two genes are directly fused and codon optimized to obtain the gene of the recombinant porcine interferon gamma-Fc fusion protein of the present invention, as shown in SEQ ID No: 1 .

[0068] The following is the codon optimization of the recombinant porcine interferon γ-Fc fusion protein. The parameters before and after optimization are compared as follows:

[0069] 1. Codon Adaptation Index (CAI)

[0070] Depend on Figure 2-a It can be seen that before codon optimization, the codon adaptation index (CAI) of the recombinant porcine interferon γ-Fc fusion protein gene in Escherichia coli was 0.64. Depend on Figure 2-b It can be seen that after codon optimization, the CAI index of the recombinant porcine interferon γ-Fc fusion protein gene in Escherichia coli is 0.84. Usually, when CAI=1, it is considered that the gene is in the most ideal high-efficiency expression state in the expression system, and the lower the CAI index, the lower the expression level of the gene in the host, so it can be seen that the codon optimization is obtained The gene sequence can improve the expression level of the recombinant porcine interferon gamma-Fc fusion protein gene in Escherichia coli.

[0071] 2. Frequency of optimal codon usage (FOP)

[0072] Depend on Figure 3-a It can be seen that, based on the E. coli expression vector, before the codon optimization, the percentage of low-utilization codons in the porcine interferon γ-Fc fusion protein gene sequence was 8%. This non-optimized gene uses tandem rare codons that may reduce translation efficiency or even dismantle translation assemblies. Depend on Figure 3-b It can be seen that after codon optimization, the frequency of low utilization codons in the recombinant porcine interferon γ-Fc fusion protein gene in the E. coli system is 0.

[0073] 3. GC base content (GC curve)

[0074] The ideal distribution area of ​​GC content is 30%-70%, and any peaks outside this area will affect transcription and translation efficiency to varying degrees. Depend on Figure 4-a , Figure 4-b The comparison of the GC base average content distribution area map of the porcine interferon γ-Fc fusion protein gene shows that, by Figure 4-a It shows that the average content of GC bases in the porcine interferon γ-Fc fusion protein gene before optimization is 52.12%, which is determined by Figure 4-b It shows that the optimized sequence eliminates 60 bases outside the region of 30%-70% GC content, and finally the average GC base content of the optimized recombinant porcine interferon γ-Fc fusion protein is 50.94%.

[0075] 3. Cis-acting elements

[0076] cis-acting element

before optimization

Optimized

E. coli_RBS (AGGAGG)

1

PolyT(TTTTTT)

1

PolyA (AAAAAAA)

1

Ch site (GCTGGTGG)

T7Cis(ATCTGTT)

[0077] 4. Remove repetitive sequences

[0078]

[0079] 5. The secondary structure prediction map of mRNA

[0080] After DNA is transcribed into mRNA, since mRNA is a single-stranded linear molecule, the complementary base pairs meet through self-folding, forming a hairpin structure (Hairpin) through hydrogen bonding. The 5' hairpin can play a regulatory role in the initiation of translation. However, if the hairpin structure is very long and the energy required for unzipping is high, it may affect translation. Therefore, the sequences that need to be expressed should try to avoid long and high-energy hairpin structures. After codon optimization, by Figure 5-a , Figure 5-b The predicted secondary structure of mRNA before and after codon optimization of porcine interferon γ-Fc fusion protein shows that the optimized 5' hairpin structure and the energy required for unzipping are more suitable for the expression of the target protein.

[0081] Embodiment 2: the expression plasmid construction of recombinant porcine interferon gamma-Fc fusion protein gene

[0082] The fragment synthesized from the optimized recombinant porcine interferon γ-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing GenScript Co., Ltd.) to obtain a long-term Save the plasmid and call it pUC57-pIFNγ-Fc plasmid. Using the pUC57-pIFNγ-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:

[0083] Upstream primers:

[0084] P1: GGGAATTCCATATGCAGGCCCCGTTTCTTCAAGG

[0085] Downstream primers:

[0086] P2: CCGCTCGAGTCATTTGCCTTGCGTTTTTGAG

[0087] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol/L, and 1 μL of dNTP at a concentration of 10 mmol/L was added. The DNA polymerase used was Phusion High-Fidelity DNA polymerase (purchased from Theromo-Fisher scientific), 2 U/μL, Add 0.5 μL. The reaction conditions were 98°C for 5s, 55°C for 45s, and 72°C for 30s. After 25 cycles, the product was analyzed by 1.0% agarose gel electrophoresis, and the product size was consistent with the expected size (1125bp). (Such as Figure 7 shown)

[0088] The obtained gene product was purified with a DNA gel recovery kit (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.). After purification, double digestion was performed with NdeI and XhoI (purchased from New England Biolabs), and the product after double digestion was ligated into pET21b plasmid (purchased from Merck) with T4 ligase (purchased from New England Biolabs), Transformed into DH5α competent cells (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight at 37°C on LB plates containing 100 μg/mL ampicillin (purchased from Amresco). The next day, the positive clones were screened, sequenced, and the comparison results showed that they were completely consistent with the expected sequence, and an expression plasmid for a form of recombinant porcine interferon γ-Fc fusion protein was obtained, which was designated as pET21b-pIFNγ-Fc.

[0089] Example 3 High-efficiency expression and identification of recombinant porcine interferon gamma-Fc fusion protein in Escherichia coli

[0090] Specific steps are as follows:

[0091] 1. Transform the pET21b-pIFNγ-Fc plasmid with correct sequence alignment in Example 2 into Escherichia coli BL21 (DE3) competent strain (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), at 37°C, on a plate containing ampicillin Incubate overnight.

[0092] 2. Pick 1-4 recombinant colonies containing the pET21b-pIFNγ-Fc plasmid the next day, insert them into LB culture medium (purchased from Amresco) containing 100 μg/mL ampicillin, and culture overnight at 37°C.

[0093] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg/mL ampicillin, and culture with shaking at 37°C.

[0094] 4. Measure the OD of the bacterial solution every 1 h after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 mmol/L IPTG (purchased from Amresco).

[0095] 5. After 4 hours of induced expression, collect the bacterial liquid, centrifuge at high speed (rotation speed: 12000rpm) for 3min, wash the precipitate with pre-cooled PBS, add 5×SDS gel loading buffer, heat at 100°C for 10min, and centrifuge at room temperature for 1min at high speed (rotational speed: 12000rpm) , take the supernatant. Recombinant E. coli cultures without the addition of IPTG were also treated in this step.

[0096] 6. Take 10 μL of the samples treated according to step 5 without adding IPTG and adding IPTG, and analyze them by 10% SDS-PAGE gel electrophoresis.

[0097] 7. Electrophoresis at 8-15V/cm until bromophenol blue migrates to the bottom of the separation gel.

[0098] 8. Coomassie Brilliant Blue staining and immunoblotting, to observe the expression product bands, see Figure 8-a and Figure 8-b.